ADN – EL CÓDIGO DE LA VIDA

ÍNDICE:

1. Introducción
2. Estructura del ADN
3. Proteínas asociadas al ADN
4. Estructuras de compactación del ADN
5. Modificaciones químicas de la Cromatina
6. Conclusión
7. Glosario

 

 

1. Introducción

El ácido desoxirribonucleico o ADN es una sustancia química que provee a las células de la información necesaria para su desarrollo, es decir dependiendo de las características biológicas de la célula, la información presente en el ADN permite el desarrollo de la misma (cigota)  hasta la formación de un organismo adulto, que tendrá ciertas característica específicas dada por esta sustancia,  permitiendo asimismo el funcionamiento celular y del organismo y la transferencia de parte de esas características a un nuevo individuo. El ADN es una molécula de gran tamaño y está formada a su vez por la agregación de tres componentes esenciales: un azúcar, un ácido y cuatro bases nitrogenadas. Los ácidos nucleicos pueden ser de distintos tipos, cumpliendo a su vez diferentes funciones dentro de la célula. En este escrito vamos a circunscribirnos al ADN y a las moléculas que lo incluyen.

 

2. Estructura del ADN

La información requerida para la formación de un gran número de proteínas, necesarias para el mantenimiento de las funciones celulares, está almacenada en moléculas primordiales denominadas ácidos nucleídos. Hace sesenta años atrás, un 25 de abril, el campo de la biología fue convulsionado por la presentación del modelo de la estructura del ácido desoxirribonucleico (ADN) publicada en una aún prestigiosa revista llamada Nature (Nº 4376, vol 171, pp737, 1953). En ese artículo James D. Watson y Francis H. C. Crick demostraron que el ADN consiste en una doble hélice, formada por dos cadenas o hebras de nucleótidos alineadas en forma antiparalela, sustentadas por interacciones entre las bases nitrogenadas de los diferentes nucleótidos. La más sencilla definición para el ADN es entonces decir que es un ácido constituido por bases nitrogenadas. Este ácido en particular es una repetición de una estructura química llamada nucleótido y cuya extensión solamente esta limitada por la capacidad de almacenamiento en el núcleo u otras organelas celulares. Cada nucleótido esta compuesto de tres elementos: Un grupo fosfato, una base nitrogenada, unidos ambos a un azúcar de cinco carbonos que en este caso se trata de una desoxirribosa. Las bases nitrogenadas que constituyen parte del ADN son cuatro: Adenina (A), Guanina (G), Citosina (C) y Timina (T). Estas son capaces de formar entre si enlaces no covalentes, denominados tipo puente de hidrógeno, respetando una estricta complementariedad: A sólo forma dos puentes de hidrógeno con T (y viceversa), y G lo hace con C (y viceversa)  mediante tres puentes de hidrógeno.

 

Los extremos de cada una de las hebras del ADN son denominados extremos 5’ y  3’. El primero corresponde al extremo terminal de un fosfato que forma una unión éster con el hidroxilo (OH) de la posición 5 de la desoxirribosa y el segundo a un extremo correspondiente al OH de la posición 3 del azúcar. Las dos cadenas se alinean en forma antiparalela, es decir en direcciones inversas (una en sentido 5-3’ y la complementaria en el sentido 3’-5’). Las características de los componentes del ADN hacen que esta macromolécula posea diferentes grados de complejidad de acuerdo se la estudie desde un punto de vista general o particular. Es decir se habla de al menos dos tipos de estructura. Una estructura primaria que tiene que ver con la secuencia de nucleótidos que conforma una cadena o hebra, y una estructura secundaria en donde se toma en cuenta la interacción de las dos cadenas antiparalelas que van a dar origen a la formación de la doble cadena helicoidal.

 

La estructura primaria sirve apara indicar la secuencia u orden en que se ubican los distintos nucleótidos en una de las cadenas. Usualmente es suficiente con indicar los nombres de las bases mediante su inicial  (A, T, C ó G)  en su orden correcto y los extremos 5' y 3'  de la cadena nucleotídica.

 

Así, por ejemplo:

5'ACGTAACGACAAGAATATTAAGGCACAAGTATATAA3'

 

La estructura secundaria, como ya ha sido mencionado,  responde al modelo de doble hélice propuesto por Watson y Crick, es decir una doble hélice formada por dos cadenas helicoidales de polinucleótidos, enrolladas la una alrededor de la otra a lo largo de un eje imaginario común, siendo el enrollamiento en sentido de las agujas del reloj (dextrógiro). Las dos cadenas son antiparalelas, es decir se disponen en sentido opuestos. Una va en sentido 3'-5' y la otra en sentido 5'-3'. Las bases nitrogenadas se sitúan hacia el interior de la doble hélice mientras que la ribosa y el ácido fosfórico forman una estructura externa, esto hace que los planos de las bases quedan perpendiculares al eje de la hélice conformado por la estructura externa. Esta ubicación de las bases nitrogenadas permite las interacciones de puente de hidrógeno que se producen entre las bases de ambas cadenas de polinucleótidos. La correspondencia     entre las bases (indicada anteriormente) explica el hecho de que las dos cadenas de la doble hélice posean secuencias que se denominan complementarias. Esta estructura secundaria y las características del proceso de síntesis de nuevas macromoléculas de ADN hace posible explicar la importancia del papel del ADN como molécula  poseedora del mensaje genético.

 

3. Proteínas asociadas al ADN

El ADN no se encuentra dentro del núcleo celular en forma libre, es decir solamente como una doble hélice de polinucleótidos, sino que existe una estructura terciaria de la cual el ADN forma parte,  y esta es la cromatina. Cromatina es un término que designa la estructura en la cual el ADN existe dentro de las células. La estructura de la cromatina está determinada y mantenida por la interacción del ADN doble cadena   con ciertas proteínas asociadas al mismo.

 

Existen dos tipos de proteínas principales que se unen al ADN. Las principales  son las histonas que están involucradas en mantener la estructura compacta de la cromatina.  Hay cinco diferentes tipos proteínas histónicas denominadas como H1,    H2A,  H2B,  H3 y  H4. La otra clase de proteínas asociadas al ADN  son un diverso grupo de proteínas llamadas simplemente, proteínas no histónicas y dentro de las mismas se incluyen los distintos factores de transcripción,  receptores hormonales, enzimas con acción de polimerasas, y otras enzimas nucleares. En cualquier célula dada  hay más de mil tipos diferentes de proteínas no histónicas unidas al ADN.

 

Las histonas tienen un papel clave en el empaquetamiento del ADN en la    célula. El empaquetamiento del ADN no es un hecho trivial, ya que aún un      organismo simple como una bacteria de Escherischia coli tiene un ADN de alrededor  de tres millones de pares de bases (bp). Esto implica una macromolécula de aproximadamente 1 mm de longitud lineal, que es mucho más que la longitud total       de esta célula. La situación es aún más dramática en una célula eucariota, por lo tanto es imprescindible que el ADN se compacte para ocupar menos espacio. El nivel de compactación más inmediato es el de la cromatina. En  células  procariotas y en  virus    se pueden producir sistemas de empaquetamiento primitivos. Por ejemplo el empaquetamiento hexagonal, donde las fibras de ADN se agrupan como si fuesen un manojo de fibras, estando este tipo de empaquetamiento estabilizado  por la interacción de proteínas muy básicas llamadas protaminas que no son histonas. Otra posibilidad  de compactación la encontramos en las cabezas de los fagos en los cuales el ADN      esta enrollado como una manguera, aprovechando de la característica del ADN para curvarse sobre si mismo. El ADN enrollado forma una estructura de unos 170 Å (Ångström) de radio, lo que  da  una estructura muy compacta,   que queda estabilizada por iones divalentes y polivalentes.

 

4. Estructuras de compactación del ADN

 

La unión del ADN a las histonas genera una estructura llamada nucleosoma. La parte central del nucleosoma contiene una estructura octamérica de proteínas que consiste en 2 subunidades cada una de H2A, H2B, H3 y H4. La histona H1 ocupa un espacio en la cadena de ADN internucleosomal y es identificada como la histona ligadora. La parte central del nucleosoma contiene aproximadamente 150 bp de ADN. La secuencia de ADN de enlace entre cada nucleosoma puede variar de 20 a más de  200 bp. En total, dentro de un pequeño núcleo de algunos mms de diámetro nos podemos encontrar con casi dos metros de ADN. Los nucleosomas, con unos 100 Å de diámetro, adoptan la forma de un collar de perlas, o Rosario, forma en que se  observa la cromatina mediante microscopía electrónica cuando la célula está en el estadio de interfase.

 

Los nucleosomas también se compactan enrollándose de manera helicoidal, formando estructuras de alrededor de 300 Å de diámetro, denominadas solenoides. Cuando la célula entra en mitosis, las fibras de cromatina se pliegan entre sí sufriendo una mayor compactación, formando los cromosomas. A pesar de este enorme grado de compactación, el  ADN  debe  ser  accesible.

 

5. Modificaciones químicas de la Cromatina

 

ADN: Los nucleosomas pueden interaccionar con numerosas moléculas. No obstante, la reactividad más relevante que poseen viene dada por su capacidad de metilarse y desmetilarse. La metilación del ácido nucleico se da principalmente en las citosinas, especialmente en aquellas secuencias ricas en CG. Evidencias diversas parecen demostrar que el patrón de metilación puede ser muy constante (es decir se desarrolla siempre en zonas similares del ADN), y de hecho se supone que el proceso de desmetilación está catalizado por enzimas específicas: llamadas ADN metilasas, lo que sugiere una relativa importancia de este proceso para la vida celular. Evidencias experimentales sugieren que la desmetilación viene asociada a la expresión del gen.

 

Histonas: Las histonas no son proteínas estáticas sin reactividad alguna, como podría sugerir su papel estructural. Por el contrario, sus cadenas laterales sufren un gran número de reacciones tales como acetilaciones, fosforilaciones, o incluso ubiquitinación. La importancia biológica de todos estos procesos es algo que no ha sido aclarado hasta la fecha, aunque a menudo se relaciona con la formación o rotura del nucleosoma. Por ejemplo, se ha sugerido que la acetilación de ciertos aminoácidos (lisinas) en la histona H4 conduce a una desestabilización del nucleosoma. También se sabe que el proceso de formación/rotura del ADN implica a menudo fosforilaciones de residuos de las histonas.

 

La epigenética es el estudio de modificaciones en la expresión de genes cuya alteración no se debe a una modificación de la secuencia del ADN (mutación) pero sin embargo son heredables. Una de las fuentes de mayores modificaciones de la expresión genética se debe al factor ambiental y puede afectar a uno o varios genes con múltiples funciones. La epigenética se relaciona entonces con el proceso de adaptación al medio ambiente dada por la plasticidad del genoma el cual tiene como resultado la formación de distintos fenotipos dependientes del medio ambiente al que sea expuesto el organismo. Al ser estas modificaciones altamente estables y heredables  permiten que se puedan mantener en un linaje celular por muchas generaciones.  La regulación epigenética se produce generalmente por cambios en la conformación de la cromatina según la interacción de esta con las histonas, o bien por alteraciones en las bases nitrogenadas y el efecto de ARN pequeños no codificables. El primero es un nivel clave de regulación ya que el estado en el que se encuentre la cromatina determina el momento, el lugar, y la forma en que un gen puede ser expresado o no. Si la cromatina se encuentra en un alto grado de condensación, los elementos de transcripción encuentran denegado el acceso a dicha región del ADN,  y por lo tanto el gen no se transcribe; es decir el gen es silenciado. En contraste, si la cromatina no se encuentra condensada, los activadores de transcripción se pueden unir  a las regiones promotoras  para que ocurra la transcripción del gen.

 

6. Conclusión

Como dijimos en la introducción, el ácido desoxirribonucleico o ADN es la sustancia química que provee a las células de la información necesaria para su desarrollo.
El ADN es el código cifrado del don y regalo de la vida, de la creación de Dios. Protegerla y cuidarla es nuestra tarea insoslayable.

 

 

7. GLOSARIO

 

BASES NITROGENADAS:

Las bases nitrogenadas son compuestos cíclicos, que incluyen dos o cuatro átomos de nitrógeno. Son parte fundamental de los nucleósidos (unidad conformada por una base y un azúcar), nucleótidos (nucleósido + un ácido fosfórico), nucleótidos cíclicos (mensajeros intracelulares AMPc y GMPc), di nucleótidos (poderes reductores, FMN, FAD, NAD, NADP), y ácidos nucleídos. Biológicamente existen seis bases nitrogenadas principales (en realidad hay muchas más), que se clasifican en tres grupos, bases isoaloxazínicas (derivadas de la estructura de la isoaloxazina, bases púricas o purinas (derivadas de la estructura de la purina), y bases pirimidinas (derivadas de la estructura de la pirimidina).  La flavina (F) es isoaloxazínica, la adelina (A) y la guanina (G) son púricas, y la timina (T), la citocina (C) y el uracilo (U) son pirimidínicas. Por convención, cada una de las bases se representa por una letra. Las bases A, T, G y C se encuentran en el ADN, mientras que en el ARN en lugar de T aparece U, por otro lado A y F  forman parte de las coenzimas de reducción y de la coenzima A.

 

PUENTE DE HIDRÓGENO:

Un enlace por puente de hidrógeno representa la fuerza atractiva entre un átomo electronegativo y un átomo de hidrógeno unido covalentemente a otro átomo electronegativo. Se produce por la formación de una fuerza dipolo-dipolo con un átomo de hidrógeno unido a un átomo de nitrógeno, oxígeno o de un halógeno generalmente flúor.

 

CROMATINA:

Se denomina cromatina a una estructura compleja compuesta de ADN y proteínas, localizada en un compartimiento celular especializado, el núcleo. Este nombre proviene de la palabra griega  "khroma",  que significa coloreado, y "soma",  que significa cuerpo.

 

HISTONAS son proteínas de soporte muy conservadas evolutivamente entre los eucariotas y algunos procariotas. Son proteínas de una masa molecular baja, aproximadamente 11-12 kilodaltons (Kd) y exhiben un alto contenido de lisina y arginina (dos de los aminoácidos básicos comunes). Las cargas positivas de las cadenas laterales de estos restos de aminoácidos, las histonas (que son extremadamente básicas), interactúan con los grupos fosfato del ADN (cargados negativamente). Las cuatro histonas centrales o nucleares,  H3 y H4,  H2A y H2B,  tienen un papel decisivo en el primer nivel de compactación del ADN dentro del núcleo. Las histonas externas, o  linker,  H1 (y H5 en aves)  interaccionan con el ADN  internucleosomal.

 

FACTORES DE TRANSCRIPCIÓN:

Los factores de transcripción son un tipo de proteínas que participan en la regulación de la transcripción del ADN, pero que no forman parte de las enzimas involucradas en el proceso. Los factores de transcripción pueden actuar reconociendo y uniéndose a secuencias concretas de ADN, uniéndose a otros factores, o uniéndose directamente a la enzima ARN polimerasa. Los factores de transcripción pueden ser activados o desactivados selectivamente por otras proteínas, a menudo como paso final de la cadena de transmisión de señales intracelulares.

 

POLIMERASAS son enzimas capaces de transcribir o replicar ácidos nucleicos. Las mismas participan en la división celular (ADN polimerasa) y en la transcripción del ADN (ARN polimerasa).

 

PARES  DE  BASES:

Un par de bases consiste en dos nucleótidos opuestos y complementarios de las cadenas de ADN y/o ARN que están asociadas por puentes de hidrógeno y se utiliza como una unidad de medida de largo de la molécula, esto es a mayor número de pares de bases mayor longitud.

 

EUCARIOTA:

Se denominan como eucariotas a todas las células con un núcleo celular delimitado por la envoltura nuclear. Es decir las células eucariotas son las que tienen un núcleo definido.

 

PROCARIOTA:

Se denominan así aquellas células en las que el material hereditario se encuentra en el seno del citoplasma en una región específica denominada nucleoide, no aislada por membranas.

 

PROTAMINA son pequeñas proteínas ricas en arginina y lisina, básicas. No se encuentran libres sino unidas a ácidos nucleicos (nucleoproteínas) y sólo se detectan en el núcleo celular.

 

ÅNGSTRÖM:

El ångström (símbolo Å http://es.wikipedia.org/wiki/%C3%85ngstr%C3%B6m - cite_note-1 ) es una unidad de longitud empleada para expresar distancias moleculares  y atómicas, muy pequeñas. Se representa por la letra sueca Å, y su equivalencia es 1 Å = 1 x 10-10 metros = 0,1 nanometros.

 

FAGOS:

Los fagos ó bacteriófagos son virus que infectan exclusivamente a las bacterias. Están constituidos por una cubierta proteica o cápside, en cuyo interior está contenido su material genético, que puede ser ADN o ARN de simple o doble cadena, circular o lineal y contiene de 5.000 a 500.000  pares de bases. Se los utiliza como herramienta para introducir una secuencia conocida de ácido nucleico.

 

NUCLEOSOMA:

El nucleosoma es una estructura que constituye la unidad fundamental y esencial de la cromatina. El nucleosoma es una estructura nuclear en la que dos vueltas de ADN (unos 83 nucleótidos por vuelta) se enrollan alrededor de un cilindro formado por 8 histonas. Dos dímeros de histona H2A-H2B se asocian a un tetrámero de histonas H3-H4. Cada nucleosoma se une al siguiente por un trozo de doble cadena de ADN, y en conjunto en microscopía electrónica ofrecen un aspecto de rosario, en el que las cuentas corresponden a nucleosomas individuales que se unen por la línea que es el ADN.  Para que se forme,  tiene que ser posible que se curve el ADN. Tener una secuencia rica en AT en el surco menor  facilita la curvatura del ADN. Debido a lo anterior secuencias de ADN con zonas ricas en AT espaciadas de tal forma que al hacer sus vueltas la cadena de ADN estas regiones de AT queden hacia el mismo lado de la doble hélice y en concreto hacia el lado que se va a asociar al centro de histonas, serán zonas que fácilmente forman parte de nucleosomas. Son la estructura fundamental por la que el ADN se empaqueta deforma que quepa en el núcleo.

 

INTERFASE es un estado dentro del proceso de división celular, en cual no se produce la división celular misma pero la célula realiza sus funciones específicas y, si está destinada a avanzar  hacia la división celular, comienza por realizar la duplicación de su ADN y la síntesis de las proteínas necesarias. Es el período comprendido entre mitosis. Es la fase más larga del ciclo celular, ocupando casi el 90% del mismo, trascurre entre dos mitosis y comprende tres etapas denominadas  Fase G1 (fase GAP), Fase S (Síntesis),  y  Fase G2 (Crecimiento).

 

MITOSIS forma parte de la llamada Fase M, en la cual se produce la división celular de una célula progenitora en dos células hijas idénticas. La mitosis, que consiste en el reparto equitativo del material hereditario característico, a su vez se divide en: profase, metafase,  anafase,  y  telofase.

 

CROMOSOMAS:

 

Se denomina así a cada uno de los cuerpos en forma de bastoncillos,  en que se organiza  la  cromatina  del  núcleo celular  durante  las  divisiones  celulares.

 

¿Cómo citar esta voz?

Sugerimos el siguiente modo de citar, que contiene los datos editoriales necesarios para la atribución de la obra a sus autores y su consulta, tal y como se encontraba en la red en el momento en que fue consultada:

Coirini, Héctor, ADN – EL CÓDIGO DE LA VIDA, en García, José Juan (director): Enciclopedia de Bioética, URL:http://enciclopediadebioetica.com/index.php/todas-las-voces/225-adn--el-codigo-de-la-vida

 

CAMPUS DE LA UNIVERSIDAD

Buscador de contenidos

Traducir esta página

¿Quién está en línea?

Hay 412 invitados y ningún miembro en línea

Estadísticas

Visitas del artículo
1854561